motA [2019-08-30 15:50:51]

H⁺-coupled MotA-MotB flagellar stator

Locus: BSU_13690

Isoelectric point: 5.01

Molecular weight: 29.19 kDa

Protein length: 270 aa

Gene length: 813 bp

Function: Motility and chemotaxis

Product: flagellar stator subunit

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Lifestyles → Exponential and early post-exponential lifestyles → Motility and chemotaxis → Flagellar proteins
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation → Other proteins required for efficient pellicle biofilm formation
• Groups of genes → Membrane proteins

Gene

Coordinates: 1,434,433 1,435,245

Phenotypes of a mutant

• loss of swimming and swarming motility PubMed
• mucoid phenotype due to the DegU-P activated overexpression of the capB-capC-capA-capE operon and resulting overproduction of poly-gamma-glutamate PubMed
• not essential for pellicle biofilm formation, but mutant is outcompeted by the wild-type strain when competed during pellicle formation PubMed

The protein

Protein family

• motA family (with MotP, according to UniProt)

Paralogous protein(s)

• MotP

Effectors of protein activity

• the interaction with MotI inhibits MotA activity PubMed

Localization

• anchored to the cell wall, extending through the cell membrane PubMed

Expression and Regulation

Operons

• Genes: motA-motB
  Description: PubMed

  Sigma factors

  • SigD: sigma factor, PubMed, in SigD regulon

Biological materials

Mutant

• 1A631 ( motA::erm), PubMed, available at BGSC
• 1A923 ( motA::erm), PubMed, available at BGSC
• DS7498 (marker-less in NCIB3610) PubMed
• BKE13690 (motA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAGTTTTCACCAAATCCT, downstream forward: _UP4_TTTGCAGAACAAGGAGAGGC
• BKK13690 (motA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAGTTTTCACCAAATCCT, downstream forward: _UP4_TTTGCAGAACAAGGAGAGGC

References

Loading